PRIMERSUITE HELP
Contents
1. Introduction
2. Citing PrimerSuite
3. PrimerSuite
4. PrimerSuite output
5. PrimerDimer
6. PrimerDimer Output
7. PrimerROC Analysis for Dimer predictions
8. PrimerPlex
9. PrimerPlex Output
10. PrimerNucleosome
11. Fragment Calculator
12. Availability
13. References
14. Acknowledgements
15. Copyright and Licence
16. Version History
17. Contact Us
1. Introduction
Primer Suite is a suite of freely available online software for generating primers for multiplex bisulfite PCR.
Multiplex bisulfite PCR resequencing is a scalable technique which can be used to analyse the methylation of multiple
regions simultaneously using minimal amounts of template DNA[1]. However primer design for bisulfite
applications is challenging due to unique limitations relating to bisulfite-converted template and multiplex reactions.
Primer Suite is a web-based primer-design application which addresses these limitations and much more. This is composed of three different modules:
o PrimerNucleosome: reports the nucleosome peaks related to input regions of interest.
o FragCalc: calculates the ratio of fragements within a sample.
o PrimerDimer: Primer dimer detecting module.
o PrimerROC: ROC analysis for Primer Dimer formation.
o PrimerPlex: Primer pooling module for arranging primers into different pools for multiplex PCR.
2. Citing PrimerSuite
We request that the use of any primers generated through PrimerSuite be cited as following:
Lu, J. Johnston, A.et al. PrimerSuite: A High-Throughput Web-Based Primer Design Program for Multiplex Bisulfite PCR.
Sci. Rep.7, 41328; doi: 10.1038/srep41328(2017).
Download citation | Download article
Johnston, A. Lu, J. et al. PrimerROC: accurate condition-independent dimer prediction using ROC analysis. (2018), Sci. Rep.
Download citation | Download article
3. PrimerSuite
Primer Design
Primer Suite can design primers for both native or bisulfite-treated DNA. For this program, the DNA/RNA sequence(s) of interest can either be entered into the textarea in a FASTA format, uploaded as a fasta file (accepts *.fa, *.fsa, *.fasta). NOTE: In the current version, Primer Suite cannot design degenerate primers and if the progam detects any non-standard bases, the input sequence(s) will be rejected. By default, Primer Suite has the bisulfite primer design function selected on start up.
I. Bisulfite Primer Design
For bisulfite primer design, it is recommended that users adjust the following parameters for optimal results, else the default values may be used (optimal conditions confirmed in the wet lab to produce quality primers).
o Location of CpG's: If any CpG's are specified above, are they situated in the 5' or the 3' of the primer
o Min CpG's in amplicon: the minimium number of CpG dinucleotides within each amplicon (including the ones within the primers)
o Primer score: the minimium number of unconverted bases from the 3' end of the Primer (e.g. the primer 'AGAAGTttttAAAGATGTGAtAGT' would return a score of 3.
II. Genomic primer design
For primer design for genomic DNA, it is recommended you adjust the following parameters for optimal results, or alternatively the default values may be used.
III. Other parameters
A common list of parameters are used Primer Suite to design primers for both bisulfite or native primers.
o Report best primers only (optional): if this is selected, PrimerSuite will only report the primer pair which best fits all the parameters specified.
o Fusion Sequence (optional): the user may choose to add fusion sequences to the 5' end of the forward and/or reverse primer. If fusion primers are added, they will be shownn in lower case letters in the final primer output (e.g. actgcgccgTTGTAAAATGTATTATtAATtAGTTG), and primer dimer will include this additional sequence in its final dimer calculations.
o Amplicon size: the optimal amplicon size range (in base pairs) for reported primer pairs.
o Oligo Melting Temperature: The optimal melting temperature (℃) of each primer pair calculated using the salt-adjusted melting temperature method [4].
o Sodium Concentration (mM): The sodium concentration (mM) of the PCR which will influence the oligo melting temperature of the oligos.
o Dimer Score (optional): Minimum Dimer Score (dS) cutoff. If this is indicated, only primers pairs with a dimer score more positive than the minimum dS will be reported.
o homopolymer(s): Homopolymeric regions consists of a string of the same bases. In PrimerSuite, homopolymers indicate the minimium stretch of contineous bases in a primer to be considered a homopolymer.
4. PrimerSuite Output
I. Bisulfite Primers
If the "Bisulfite" option is selected, Primer Suite will return an excel workbook with three spreadsheets with the result primers.
o Ga primers: primers found on the G → A strand of the sequence(s).
o Parameters: summary of all the parameters used to construct the primers
o Regions with no primers: list of all regions in which no primers can be designed using the current parameters
o Forward primer seq: Forward primer sequence. Unconverted bases are shown in uppercase letters while converted bases are in lowercase letters. CpG dinucleotides, if specified are flagged as 'Ng' or 'cN' in the Ct and Ga strands respectively.
o Forward fusion primer seq*: The forward fusion primer is displayed with the fusion sequence (at the 5' end in lowercase (e.g. actgcgccgTTGTAAAATGTATTATtAATtAGTTG).
o Reverse primer name: Blank field for user to input name of reverse primer.
o Reverse primer seq: Reverse primer sequence. Unconverted bases are shown in uppercase letters while converted bases are in lowercase letters. CpG dinucleotides, if specified are flagged as 'Ng' or 'cN' in the Ct and Ga strands respectively.
o Reverse fusion primer seq*:The reverse fusion primer is displayed with the fusion sequence at the 5' end in lowercase (e.g. actgcgccgTTGTAAAATGTATTATtAATtAGTTG).
o Region: Name of the sequence (e.g. Chr8: 1234-55696)
o Amplicon Start: The starting coordinate of the target amplicon (i.e. forward primer) in the template DNA.
o Amplicon End: The end coordinate of the target amplicon (i.e. reverse primer) in the template DNA.
o Amplicon size: The size of the amplified product in base pairs (bp).
o CpG in Amplicon: The number of CpG dinucleotides in the amplicon (including these in the forward and reverse primers.
o Dimer Score: Score used to determine the stability between the binding of two primer pairs calculated based on a method based on Sainta Lucia's free energy calculations. The lower the score, the more stable it is and therefore the more likely the primers are to form dimers.
o Dimer Structure The source of the dimer score. Whether it is from dimerisation between the forward and reverse primer (heterodimer) or between two of the same primers (homodimers).
o Dimer Bands (Y/N) Adjustable field for the user to input whether dimer structures were observed (later during PCR validation of primers).
o Ct (qPCR): Adjustable field for the user to input of the Cycle threshold (Ct, from qPCR). This value will be used by Primer plex to sort primers into different pools.
o Forward Tm: The salt-adjusted melting temperature of the forward primer.
o Reverse Tm: The salt-adjusted melting temperature of the reverse primer.
o Forward primer score: The number of unconverted bases at the 3' end of the forward primer (e.g.TGTAAAATGTATTggATtAATtAGTTG has a primer score of 5).
o Reverse primer score: The number of unconverted bases at the 3' end of the reverse primer (e.g.TGTAAAATGTATTggATtAATtATTG has a primer score of 4).
o Forward PolyX: Reports TRUE if a continuous stretch of the same bases are found in the forward primer. This is determined by the specified homopolymers in parameters.
o Reverse PolyX: Reports TRUE if a continuous stretch of the same bases are found in the reverse primer. This is determined by the specified homopolymers in parameters.
o Forward GC%: The proportion of Guanine and Cytosine in the forward primer expressed as a %.
o Reverse GC%: The proportion of Guanine and Cytosine in the reverse primer expressed as a %.
o Forward CpG count#: The number of CpG dinucleotides in the forward primer. For primers targeting the Ct sequence, it is flagged as 'Ng', and 'cN' in the Ga sequence.
o Forward CpG Position@: The location of the CpG dinucleotide(s) in the forward primer (ie. either 5' or 3')
o Reverse CpG count#: The number of CpG dinucleotides in the reverse primer.
o Reverse CpG Position@: The location of the CpG dinucleotide(s) in the reverse primer (ie. either 5' or 3')
o Forward Repeat CheckM: If the "Repbase check" is selected, all the forward primers will be screened against a "mispriming library" derived from Primer3 [3]. Primers that are shown to "misprime" will be flagged in the result spreadsheet with "Mispriming event found".
o Reverse Repeat CheckM: If the "Repbase check" is selected, all the reverse primers will be screened against a "mispriming library" derived from Primer3 [3]. Primers that are shown to "misprime" will be flagged in the result spreadsheet with "Mispriming event found".
# Only reported if the user required one or more CpG's in the primers.
@ Only reported if the user required any CpG's within the primers
M Only reported if the user requested to have the primers screened against the mispriming library.
II. Genomic Primers
If the "Genomic" option is selected, Primer Suite will return an excel workbook with two spreadsheets with the result primers.
o Parameters: a summary of all the parameters used to construct the primers.
o Forward primer seq: Forward primer sequence.
o Forward fusion primer seq*: The forward fusion primer is displayed with the fusion sequence (at the 5' end in lowercase (e.g. actgcgccgTTGTAAAATGTATTATtAATtAGTTG).
o Reverse primer name: Blank field for user to input of name of reverse primer.
o Reverse primer seq: Reverse primer sequence.
o Reverse fusion primer seq*:The reverse fusion primer is displayed with the fusion sequence at the 5' end in lowercase (e.g. actgcgccgTTGTAAAATGTATTATtAATtAGTTG).
o Dimer Score: Score used to determine the stability between the binding of two primer pairs calculated based on a method based on Sainta Lucia's free energy calculations. The lower the score, the more stable it is and therefore the more likely the primers are to form dimers.
o Dimer Structure: The source of the dimer score. Whether it is from dimerisation between the forward and reverse primer (heterodimer) or between two of the same primers (homodimers).
o Dimer Bands (Y/N) Adjustable field for the user to input whether dimer structures were observed (later during PCR validation of primers).
o Ct (qPCR): Adjustable field for the user to input of the Cycle threshold (Ct, from qPCR). This value will be used by Primer plex to sort primers into different pools.
o Region: Name of the sequence (e.g. Chr8: 1234-55696)
o Amplicon start: Starting coordinate of the target amplicon (i.e. forward primer)in the template DNA.
o Amplicon end: The end coordinate of the target amplicon (i.e. reverse primer) in the template DNA.
o Amplicon size: The size of the amplified product in base pairs (bp).
o Forward Tm: The salt-adjusted melting temperature of the forward primer.
o Reverse Tm: The salt-adjusted melting temperature of the reverse primer.
o Forward polyX: Reports TRUE if a continueous stretch of the same bases are found in the forward primer.
o Reverse polyX: Reports TRUE if a continueous stretch of the same bases are found in the reverse primer
o Forward GC%: The proportion of Guanine and Cytosine in the forward primer expressed as a %.
o Reverse GC%: The proportion of Guanine and Cytosine in the reverse primer expressed as a %.
o Forward Repeat CheckM: If the "Repbase check" is selected, all the forward primers will be screened against a "mispriming library" derived from Primer3 [3]. Primers that are shown to "misprime" will be flagged in the result spreadsheet with "Mispriming event found".
o Reverse Repeat CheckM: If the "Repbase check" is selected, all the reverse primers will be screened against a "mispriming library" derived from Primer3 [3]. Primers that are shown to "misprime" will be flagged in the result spreadsheet with "Mispriming event found".
M Only reported if the user requested to have the primers screened against the mispriming library.
5. PrimerDimer
PrimerDimer can be accessed via www.primer-dimer.com. Users may choose to either paste their primer sequences in the textarea, or upload a file in FASTA format.
PrimerDimer only looks for 'extension dimers' (dimers which has the potential to extend from the 3' end), which has been found to be the most problematic during our wet lab validations. Please note, in either input options, input primer pairs must be listed in the order below:
<forward_primer_one_sequence>
>Reverse Primer One Name
<reverse_primer_one_sequence>
>Forward Primer Two
<forward_primer_two_sequence>
>Reverse Primer Two
<reverse_primer_two_sequence>
o Multiplex Analysis: each primer is screened aginst all other primers within the pool for potential dimer formations.
6. PrimerDimer Output
Primer Dimer may output the results in two different formats:
o Forward primer seq: Forward primer sequence.
o Reverse primer name: Name of the reverse primer.
o Reverse primer seq: Reverse primer sequence.
o Dimer Score: Score used to determine the stability between the binding of two primer pairs calculated based on a method based on Sainta Lucia's free energy calculations. The lower the score, the more stable it is and therefore the more likely the primers are to form dimers.
o Dimer Structure: indicates whether the most stable structure is formed between two of the same primers (ie. homodimers) or two different primers within a pair (ie. heterodimers).
########################################################################################
# #
# PrimerDimer Report #
# #
########################################################################################
>>> - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - <<<
Dimer Score for C825 vs C827 is -3.93.
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
5'> GTCATGCGCCCCATAGAATTTTTATTTGGTTTTATTTTTGTA >3'
| | ||| ||||| |||
3'< ACTCCCAAAAAATTAAAATCATAAATTACCCCGCGTACTG <5'
>>> - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - <<<
****************************************************************************************
>>> - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - <<<
Second primer pair
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
.
.
.
>>> - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - <<<
****************************************************************************************
########################################################################################
# #
# End of Report #
# #
########################################################################################
7. PrimerROC Analysis for Dimer Predictions
The 'ROC Analysis for Dimer Predictions' is an extension of the Primer Dimer module. The function of this program is to predict the optimal min ΔG at which dimers form for group of primers which is unique to each lab. The program will construct an ROC curve based on the free energy calculations, which is uploaded as a .png file. The program will also report the area under curve (AUC) and the minimum ΔG cutoff at which point dimers start forming. Based on this analysis, users can pick the optimal primers to use for their relavent experiments. For this analysis, users are required to first perform a 'validation' PCR on their primers and note the presence or absence of dimer artefacts for each primer pair. Results can then be recorded in the PrimerSuite result sheet (if you used our Primer Suite program to design the primers), or fill in the Primer Dimer template file. The template contains a sample set of data which has been used in our research facilities to predict the optimum dimer score of the assay.
8. PrimerPlex
The PrimerPlex module is available at www.primer-plex.com. The purpose of this program is to organise primer pairs into different pools for multiplex PCR [5]. For this process, users are required to input an excel file with all the primers they wish to input with the following mandatory fields from the Primer Suite program:
o Forward Primer Seq: Sequence of the forward primer.
o Reverse Primer Name: Name of the reverse primer.
o Reverse Primer Seq: Sequence of the reverse primer.
o Region: Name of the template DNA the primers were designed from.
o Amplicon Start: Starting coordinate of the coordinate of the amplicon (ie. starting forward primer) with reference to the template sequence.
o Amplicon End: Ending coordinate of the finishing coordinate of the amplicon (ie. reverse primer) with reference to the template sequence.
o Ct (qPCR): Cycle threshold value (obtained from qPCR)
In the current version, the program will only process up to 40 primer pairs. If you need to process larger quantities, please contact admin, or process the primer pairs in differnt batches
o Ct range: The ct range within each pool. For a Ct range of 5, primer pairs within each pool must have ct within 5 cycles of one another.
o Amplicon distance: The minimium distance (in base pairs) between each amplicon in a primer pool.
o X-plex: The maximium number of primer pairs within a primer pool.
9. PrimerPlex Output
Results from PrimerPlex will be reported in an excel workbook. Each primer pool is reported in a seperate spreadsheet and is named pool n (primer pool number). The parameters are summarized in a final spreasheet titled 'Parameters'.
10. PrimerNucleosome
Pending more information.
11. FragCalc
The Fragment Calculator module is available at: http://www.primer-suite/fragcalc. Inputs:
o Small copy number (125): Concentration of 125 bp assay
o Big copy number (175): Concentration of 175 bp assay
This tool uses concentrations measured by 175 bp and 125 bp amplicons and the [175bp]/[125bp] ratio of these concentrations to estimate the average fragment length of a genomic or bisulfite-converted human DNA sample, the total number of genome copies in a measured sample, as well as the number of amplifiable (unbroken) instances of a DNA region of any length.
This tool uses the fragment size distribution data of seven sonicated DNA samples with average fragment lengths of 254, 291, 428, 493, 590, 745 and 1274 bp, a highly fragmented FFPE DNA sample with an average fragment length of 92 bp to represent the lower bounds of random fragmentation, and four gDNA samples with average fragment lengths of 6714, 15422, 34625 and 41496 bp for the upper bounds.
The [long]/[short] ratios of any two region lengths is determined by applying the following equation to fragment size distribution data:
where:
f:length at which the DNA is fragmented
b: length of the longer region (175 bp)
s: length of the shorter region (125 bp)
n length of the longest fragment within the sample
m length of the shortest fragment within the sample
Cf: concentration of each fragment length (i.e. pg/µL)
To estimate the concentration of a 50 bp region, for example, the corresponding [125bp]/[50bp] ratios determined using Equation 3 are 0.585 and 0.707, for the 291 bp and 428 bp reference samples, respectively. The 50 bp concentration is then calculated using the following linear equation:
where m is the slope and y0 is the y-intercept. The number of genome copies is also estimated using this same method by dividing the input 125 bp concentration by the [125bp]/[1bp] ratio. Similarly, the average fragment length is estimated using the [175bp]/[125bp] ratios from our fragment size distribution data (x1, x2) and their corresponding average fragment lengths (y1, y2).
12. Availability
o The PrimerSuite interface is freely available at www.primer-suite.com.
o The PrimerDimer interface is freely available at www.primer-dimer.com.
o The PrimerROC interface is freely available at www.primer-dimer.com/roc.
o The PrimerPlex interface is freely available at www.primer-plex.com.
o The FragCalc module is freely available at www.primer-suite.com/fragcalc.
o The PrimerNucleosome module is freely available at www.primer-suite.com/nucleosome.
Further information can be obtained by emailing us at jennifer.lu@uqconnect.edu.au or via the FAQs section in PrimerSuite resources.
13. Acknowledgements
We wish to thank Fiach Antaw for his valuable input during the development of the program.
14. COPYRIGHT AND LICENSE
Copyright (c) 2015 Australian Institute for BioEngineering and Nanotechnology (AIBN), Centre for Personalised Nanomedicine, Trau Lab, Jennifer Lu and Darren Korbie. All rights reserved.
The Primer Suite software is a free software for researchers. This software is distributed in the hope that it will be useful to the field of epigenetic bioinformatics, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for more details.
THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT OWNERS OR CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE.
15. Version History
2015 Sept - The initial launch of PrimerSuite.2016 Mar - Review and improvement of PrimerSuite.
2017 Jan - Publication of PrimerSuite manuscript in Nature Scientific Reports.
2017 Feb - Update of PrimerSuite 'Help' and 'Resources' page to include citations and PrimerSuite article.
2017 Dec - Update of PrimerDimer module and relaunch of PrimerROC module
2018 Dec - Launch of PrimerNucleosome and Fragcalc modules on the PrimerSuite site.
16. REFERENCES
[2]Dieffenbach, C. W. Lowe, T. M. Dveksler, G. S. "General Concepts for PCR Primer Design", PCR Methods Appl. 1993 Dec;3(3):S30-7
[3]Koressaar T, Remm M (2007) Enhancements and modifications of primer design program Primer3 Bioinformatics 23(10):1289-91
[4]Nakano S, Fujimoto M, Hara H, Sugimoto N. "Nucleic acid duplex stability: influence of base composition on cation effects", Nucleic Acids Res. 1999 Jul 15;27(14):2957-65
[5]P. Markoulatos, N. Siafakas and M. Moncany, "Multiplex polymerase chain reaction: a practical approach", J Clini Lab Anal, 2002; 16(1):47-51.
[6]Repbase - http://www.girinst.org/repbase/index.html
17. CONTACT US
The developers of Primer Suite can be contacted via email at jennifer.lu@uqconnect.edu.au.